View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_high_37 (Length: 290)
Name: NF1911_high_37
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_high_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 17 - 261
Target Start/End: Complemental strand, 37123602 - 37123353
Alignment:
| Q |
17 |
accgtcaactatttgatttaaagtatatt------tgatattgatttgtagtagctcataggaagagatatgcttgagatttatcatnnnnnnntgcagt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
37123602 |
accgtcaactatttgatttaaagtatattatattgtgatattgatttgtagtaactcacaggaagagatatgcttgagatttatcataaaaaaatgcagt |
37123503 |
T |
 |
| Q |
111 |
tgaacaaatcaaataagagagaaagaatctgtcgtgcaatatgaacgaaaaatcctctcgttcactttagcatttttcgnnnnnnnnntactactcctag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||| || | | || |
|
|
| T |
37123502 |
tgaacaaatcaaataagagagaaagaatttgtcgtgcaatatgaacgaaaaattctctcgtgcactttagcatttttcaaaaaaaaaataaaattact-c |
37123404 |
T |
 |
| Q |
211 |
gtacgactcttattttaatacggatggaggaatcaatctagatgagatatt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37123403 |
ctacgactcttattttaatacggatggaggaatcaatctagacgagatatt |
37123353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University