View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_high_48 (Length: 250)
Name: NF1911_high_48
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 240
Target Start/End: Original strand, 4073922 - 4074147
Alignment:
| Q |
16 |
cttacttctattt-atagagatagaatttttcacaaacttttgatgctttttaatataaataacaaaatactctagttataaactataagagtgaagttt |
114 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
4073922 |
cttacttctattttatagagatagaatttttcacaaacttttgatactttttaatataaataacaaaatactctagttataaattacaagagtgaagttt |
4074021 |
T |
 |
| Q |
115 |
tattcttgcctctcacgcaattatgaaatccaatttagtcctttacaagaagnnnnnnnnctcaagttccctctctcaagaaaataaaccgacacaagct |
214 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4074022 |
tattcttacctctcacgcaattatgaaatccaatttagtcctttacaagaaaaaaaaacactcaagttccctctctcaagaaaataaaccgacacaagct |
4074121 |
T |
 |
| Q |
215 |
agtcccctaaatcaaaaaatttcaac |
240 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
4074122 |
agtcccctaaatcaaaaaaattcaac |
4074147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University