View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_high_51 (Length: 244)
Name: NF1911_high_51
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_high_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 7 - 156
Target Start/End: Complemental strand, 54932229 - 54932080
Alignment:
| Q |
7 |
tcgaagaaaattagacaatatctgaatgagactacctatatcaacaaattggagaggctatgggcttgcttgcagctatcatgtgaatgagggagttgga |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54932229 |
tcgaataaaattagacaatatctgaatgagactacctatatcaacaaattgatgaggctatgggcttgcttgcagctatcatgtgaatgagggagttgga |
54932130 |
T |
|
| Q |
107 |
gtttaagaaggtcgttgtgttcaagaagttattgaaacaccatttaattt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54932129 |
gtttaagaaggtcgttgtgttcaagaagttattgaaacaccatttaattt |
54932080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 180 - 216
Target Start/End: Complemental strand, 33954789 - 33954753
Alignment:
| Q |
180 |
cgtttacattggccaaacctccgtttgctttttcaaa |
216 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33954789 |
cgtttacagtggccaaacctccgtttgctttttcaaa |
33954753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 180 - 224
Target Start/End: Original strand, 14071709 - 14071753
Alignment:
| Q |
180 |
cgtttacattggccaaacctccgtttgctttttcaaatgccgttt |
224 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
14071709 |
cgtttacagtggctaaacctccgtttgctttttcaaacgccgttt |
14071753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University