View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1911_high_58 (Length: 239)

Name: NF1911_high_58
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1911_high_58
NF1911_high_58
[»] chr3 (1 HSPs)
chr3 (112-221)||(38516708-38516817)


Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 112 - 221
Target Start/End: Original strand, 38516708 - 38516817
Alignment:
112 ttgatgagtaaatgcaatagtgtggtctcgtttcctatttaatgatgagattgaggagagatgatggatctctatattaaggcacttccacggtagctaa 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38516708 ttgatgagtaaatgcaatagtgtggtctcgtttcctatttaatgatgagattgaggagagatgatggatctctatattaaggcacttccacggtagctaa 38516807  T
212 acgtcattat 221  Q
    ||||||||||    
38516808 acgtcattat 38516817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University