View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1911_high_70 (Length: 231)

Name: NF1911_high_70
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1911_high_70
NF1911_high_70
[»] chr2 (1 HSPs)
chr2 (16-118)||(41845420-41845522)


Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 16 - 118
Target Start/End: Original strand, 41845420 - 41845522
Alignment:
16 aatattactagatcccccacttgaatcagcaataatgacagaagaaatctttggccctgtgcttcccataataactgtaagatatatatctgcaacataa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41845420 aatattactagatcccccacttgaatcagcaataatgacagaagaaatctttggccctgtgcttcccataataactgtaagatatatatctgcaacataa 41845519  T
116 ttt 118  Q
    |||    
41845520 ttt 41845522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University