View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_high_72 (Length: 222)
Name: NF1911_high_72
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_high_72 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 11 - 205
Target Start/End: Original strand, 37304230 - 37304424
Alignment:
| Q |
11 |
cgaagaatataggttttgatcccctacaatagcgttgctgcaccgtgcaactgttgtaggggatccaagacctcgaatgtatttgttatctcatttttta |
110 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37304230 |
cgaaaaatataggtttcgatcccctacaatagtgttgttgcaccgtgcaactgttgtaggggatccaagacctcgaatgtatttgttatctcatttttta |
37304329 |
T |
 |
| Q |
111 |
accgcatttagttcaaccagattggtctcgatatatgtgtctatcaatcgcaccataaacttggtgtagtttttgaatcaatgcgatgaatgtat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37304330 |
accgcatttagttcaaccagattggtctcgatatatgtgtctatcaatcgcaccataaacttggtgtagtttttgaatcaatgcgatgaatgtat |
37304424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University