View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_11 (Length: 463)
Name: NF1911_low_11
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 6e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 13 - 192
Target Start/End: Original strand, 8922767 - 8922947
Alignment:
| Q |
13 |
aaaattaagaaattaacaattataaaaccatattatgaaattttaaataattttacgacgttttagtttttggcaatatattatcttttaaaagcatctc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8922767 |
aaaattaagaaattaacaattataaaaccatattacgaaattttaaataattttacgacgttttagtttttggcaatatattatcttttaaaagcatctc |
8922866 |
T |
 |
| Q |
113 |
caatgctcacttttttaacaaaataacgtttgcatgtttaga-nnnnnnnggtggtgctttgcatgtttagattgagaaca |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8922867 |
caatgctcacttttttaacaaaataacgtttgcatgtttagattttttttggtggtgctttgcatgtttagattgagaaca |
8922947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 349 - 447
Target Start/End: Original strand, 8922975 - 8923073
Alignment:
| Q |
349 |
acgtggaaaacattttccgagatctctcaatgcatgtcttgtacacttgattacgagttgagacacttaattagttgatatattgattattgcaccata |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8922975 |
acgtggaaaacattttccgagatctctcaatgcatgtcttgtacacttgattacgagttgagacacttaattagttgatatattgattattgcaccata |
8923073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University