View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_18 (Length: 421)
Name: NF1911_low_18
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_18 |
 |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 299; Significance: 1e-168; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 18 - 406
Target Start/End: Complemental strand, 23336761 - 23336375
Alignment:
| Q |
18 |
gcatgtagaatggttgagtagttttcaaagctctaagttcttgaagttctttttgtaatcttctattctcttctgttaatgtctcacaacatctcttcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23336761 |
gcatgtagaatggttgagtagttttcaaagctctaagctcttgaagttccttttgtaatcttctattctcttctgttaatgtctcacaacatctcttcaa |
23336662 |
T |
 |
| Q |
118 |
atactcacaatccacttctgtttgctttaacttcgtcctacaaaatcacaaattccaaaccaaaactttaataaaaaatagtctctgctcaggtgatagc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23336661 |
atactcacaatccacttctgtttgctttaactttgtcctacaaaatcacaaattccaaaccaaaactttaataaaaaatagtctctgctcaggtggtagc |
23336562 |
T |
 |
| Q |
218 |
aacatccattgttatatgcaggggctgaggttcgaactccggacacccaacacgttcaaaagaattaaagtattac-annnnnnnatcttattgttttgg |
316 |
Q |
| |
|
||||| |||||||||||||||||| || ||||| |||||||||||||| ||||||||||||||||| ||||||||| | ||||||| ||||||| |
|
|
| T |
23336561 |
aacatgcattgttatatgcaggggttgtggttcaaactccggacaccccacacgttcaaaagaattcaagtattacaatttttttatcttatggttttgg |
23336462 |
T |
 |
| Q |
317 |
tttagttcaaacaaaatttattcatattagaatactagtatttgattttaattcctcaaaatagactctaaaataaaatattagaaaaat |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23336461 |
tttagttcaaacaaaatttattcatattagaatac---tacttgattttaattcctcaaaatagactctaaaataaaatattagaaaaat |
23336375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 7015758 - 7015712
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
7015758 |
acatgcattgttatatgtaggggctgaggttcgaactccgaacaccc |
7015712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 7906397 - 7906351
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| | |||||||| |
|
|
| T |
7906397 |
acatgcattgttatatgcaggggctggggttcgaacccgggacaccc |
7906351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 50199547 - 50199501
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| ||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
50199547 |
acatgcattgttatatgcaggggccggggttcgaaccccggacaccc |
50199501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Original strand, 39238745 - 39238786
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
39238745 |
cattattatatgcaggggccgaggttcgaaccccggacaccc |
39238786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 219 - 268
Target Start/End: Complemental strand, 40454242 - 40454193
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacacccaac |
268 |
Q |
| |
|
|||| |||| ||||||||| |||| | ||||||||||||||||||||||| |
|
|
| T |
40454242 |
acatgcattattatatgcaagggccggggttcgaactccggacacccaac |
40454193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 265
Target Start/End: Complemental strand, 47469103 - 47469070
Alignment:
| Q |
232 |
tatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
47469103 |
tatgcaggggctgaggttcgaaccccggacaccc |
47469070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 204 - 264
Target Start/End: Original strand, 1721149 - 1721209
Alignment:
| Q |
204 |
gctcaggtgatagcaacatccattgttatatgcaggggctgaggttcgaactccggacacc |
264 |
Q |
| |
|
|||||| || ||| ||||| ||||||||||||||||||| | | ||||||| ||||||||| |
|
|
| T |
1721149 |
gctcagttggtaggaacatgcattgttatatgcaggggccgggtttcgaaccccggacacc |
1721209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 71; Significance: 5e-32; HSPs: 13)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 18 - 156
Target Start/End: Complemental strand, 37140743 - 37140605
Alignment:
| Q |
18 |
gcatgtagaatggttgagtagttttcaaagctctaagttcttgaagttctttttgtaatcttctattctcttctgttaatgtctcacaacatctcttcaa |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | ||| |||||||| |||||||||||| |||| |||||||| | |||||||||||||| || || |
|
|
| T |
37140743 |
gcatgtagaatggttgagaagttttcaaagctctcaattcctgaagttccttttgtaatcttttattttcttctgtcagagtctcacaacatctttttaa |
37140644 |
T |
 |
| Q |
118 |
atactcacaatccacttctgtttgctttaacttcgtcct |
156 |
Q |
| |
|
|| |||||||||||||| ||||||||| |||| ||||| |
|
|
| T |
37140643 |
gtattcacaatccacttccgtttgctttgacttggtcct |
37140605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 265
Target Start/End: Original strand, 42887183 - 42887224
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42887183 |
cattattatatgcaggggctgaggttcgaaccccggacaccc |
42887224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 229 - 265
Target Start/End: Complemental strand, 22706089 - 22706053
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22706089 |
ttatatgcaggggctgaggttcaaactccggacaccc |
22706053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Original strand, 19126766 - 19126807
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
19126766 |
cattattatatacaggggctgaggttcgaaccccggacaccc |
19126807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 21285419 - 21285378
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
21285419 |
cattgttatatgcaggggccggggttcgaaccccggacaccc |
21285378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 29658338 - 29658297
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
29658338 |
cattgttatatgcaggggccggggttcgaaccccggacaccc |
29658297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 219 - 264
Target Start/End: Complemental strand, 37410552 - 37410507
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacacc |
264 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37410552 |
acatgcattgttatatgcaggggtcaaggttcgaactccggacacc |
37410507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Original strand, 42286353 - 42286394
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| |||||||||| |
|
|
| T |
42286353 |
cattgttatatgtaggggctgaggtttgaacaccggacaccc |
42286394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 265
Target Start/End: Complemental strand, 18503513 - 18503477
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |
|
|
| T |
18503513 |
ttatatgcaggggctgaggttcgaaccccagacaccc |
18503477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 265
Target Start/End: Complemental strand, 20101685 - 20101649
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |
|
|
| T |
20101685 |
ttatatgcaggggccggggttcgaactccggacaccc |
20101649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 211 - 267
Target Start/End: Complemental strand, 32834382 - 32834326
Alignment:
| Q |
211 |
tgatagcaacatccattgttatatgcaggggctgaggttcgaactccggacacccaa |
267 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||| | |||| ||||||||||| |||| |
|
|
| T |
32834382 |
tgataggaacatgcattgttatatgcaggggccggcgttcaaactccggacaaccaa |
32834326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 265
Target Start/End: Original strand, 34891243 - 34891279
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |
|
|
| T |
34891243 |
ttatatgcaggggccggggttcgaactccggacaccc |
34891279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 257
Target Start/End: Original strand, 49005503 - 49005531
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactcc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49005503 |
ttatatgcaggggctgaggttcgaactcc |
49005531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 1e-20; HSPs: 9)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 37 - 156
Target Start/End: Original strand, 25901597 - 25901716
Alignment:
| Q |
37 |
agttttcaaagctctaagttcttgaagttctttttgtaatcttctattctcttctgttaatgtctcacaacatctcttcaaatactcacaatccacttct |
136 |
Q |
| |
|
|||||| |||||||| | |||||||||||| || |||| || ||||| |||||||||| ||| ||||| |||||||| || || ||||||||||||||| |
|
|
| T |
25901597 |
agtttttaaagctcttaattcttgaagttccttgtgtagcctcctattttcttctgttagtgtttcacagcatctctttaagtattcacaatccacttct |
25901696 |
T |
 |
| Q |
137 |
gtttgctttaacttcgtcct |
156 |
Q |
| |
|
|||||||| ||||| ||||| |
|
|
| T |
25901697 |
gtttgcttcaacttagtcct |
25901716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 229 - 265
Target Start/End: Complemental strand, 11050790 - 11050754
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11050790 |
ttatatgcaggggctggggttcgaactccggacaccc |
11050754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 224 - 263
Target Start/End: Complemental strand, 17982562 - 17982523
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacac |
263 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
17982562 |
cattgttatatgcagggactgaggttcgaactctggacac |
17982523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 229 - 263
Target Start/End: Complemental strand, 9330534 - 9330500
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacac |
263 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
9330534 |
ttatatgcaggggctgaggtgcgaactccggacac |
9330500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 3037688 - 3037647
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
3037688 |
cattgttatatgcaggggccggggttcgaaccccggacaccc |
3037647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 18386878 - 18386837
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| ||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
18386878 |
cattattatatgtaggggctggggttcgaactccggacaccc |
18386837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 224 - 264
Target Start/End: Original strand, 18065283 - 18065323
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacacc |
264 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||| ||||| |
|
|
| T |
18065283 |
cattgttatatgcaggggttgaggttcgaaccccgaacacc |
18065323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 265
Target Start/End: Original strand, 34107308 - 34107344
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
34107308 |
ttatatgcaggggttgaggttcgaactccagacaccc |
34107344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 265
Target Start/End: Original strand, 36101696 - 36101732
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
36101696 |
ttatatgcaggggctggggttcgaaccccggacaccc |
36101732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 7e-16; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 41 - 156
Target Start/End: Complemental strand, 891235 - 891120
Alignment:
| Q |
41 |
ttcaaagctctaagttcttgaagttctttttgtaatcttctattctcttctgttaatgtctcacaacatctcttcaaatactcacaatccacttctgttt |
140 |
Q |
| |
|
||||| || ||||| ||||| | ||| ||||| || || |||||||| || |||| |||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
891235 |
ttcaatgccctaagctcttgcacttccttttgcaacctcctattctcatcagttagagtctcacagcatctcttcaagtactcacaatccacttcagttt |
891136 |
T |
 |
| Q |
141 |
gctttaacttcgtcct |
156 |
Q |
| |
|
|||| ||||| ||||| |
|
|
| T |
891135 |
gcttcaacttggtcct |
891120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 229 - 265
Target Start/End: Complemental strand, 8740717 - 8740681
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8740717 |
ttatatgcaggggctgaggttcgaactccggacaccc |
8740681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 229 - 265
Target Start/End: Original strand, 28378846 - 28378882
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28378846 |
ttatatgcaggggctgaggttcgaaccccggacaccc |
28378882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Original strand, 7314762 - 7314803
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
7314762 |
cattattatatgcaggggccgaggttcgaaccccggacaccc |
7314803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Original strand, 14012641 - 14012682
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
||||||||||||||||||| | |||||||| ||||||||||| |
|
|
| T |
14012641 |
cattgttatatgcaggggccggggttcgaagtccggacaccc |
14012682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 265
Target Start/End: Original strand, 44444581 - 44444617
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
44444581 |
ttatatgcaggggctggggttcgaaccccggacaccc |
44444617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 13)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 80 - 144
Target Start/End: Complemental strand, 40300384 - 40300320
Alignment:
| Q |
80 |
ctattctcttctgttaatgtctcacaacatctcttcaaatactcacaatccacttctgtttgctt |
144 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| | ||||||||||||||||||||||||| |
|
|
| T |
40300384 |
ctattctcttctgttaatgtttcacaacatttctttaggaactcacaatccacttctgtttgctt |
40300320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 34773749 - 34773708
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34773749 |
cattattatatgcaggggctgaggttcgaaccccggacaccc |
34773708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 219 - 264
Target Start/End: Original strand, 36045854 - 36045899
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacacc |
264 |
Q |
| |
|
|||| |||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
36045854 |
acatgcattgttatatgcaggggttgagattcgaactccggacacc |
36045899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 56531302 - 56531261
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
56531302 |
cattgttatatgcaggggccggggttcgaactccggacaccc |
56531261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 219 - 262
Target Start/End: Original strand, 18497416 - 18497459
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggaca |
262 |
Q |
| |
|
|||| |||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
18497416 |
acatgcattgttatatgcaggggttggggttcgaactccggaca |
18497459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 219 - 262
Target Start/End: Original strand, 20610763 - 20610806
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggaca |
262 |
Q |
| |
|
|||| ||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
20610763 |
acatgcattgttatatgcaggggccggggttcgaactccggaca |
20610806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 229 - 263
Target Start/End: Complemental strand, 24680119 - 24680085
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacac |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24680119 |
ttatatgcaggggctgaggttcgaactccagacac |
24680085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 49039516 - 49039470
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| ||||||||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
49039516 |
acatgcattgttatatgcagggactggggttcgaaccccggacaccc |
49039470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 219 - 264
Target Start/End: Original strand, 38657564 - 38657609
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacacc |
264 |
Q |
| |
|
|||| ||||||||||||||||| |||| |||||||||||| ||||| |
|
|
| T |
38657564 |
acatgcattgttatatgcagggactgaagttcgaactccgaacacc |
38657609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 41003237 - 41003197
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
41003237 |
cattgttatatgcaggggttgag-ttcgaactccggacaccc |
41003197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Original strand, 53815725 - 53815766
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
53815725 |
cattattatatgcaggggctggggttcgaaccccggacaccc |
53815766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 265
Target Start/End: Complemental strand, 3036088 - 3036052
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
3036088 |
ttatatgcaggggccgaggttcgaaccccggacaccc |
3036052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 265
Target Start/End: Original strand, 32760679 - 32760715
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||| |
|
|
| T |
32760679 |
ttatatgcaggggttggggttcgaactccggacaccc |
32760715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000002; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 227 - 265
Target Start/End: Original strand, 2816925 - 2816963
Alignment:
| Q |
227 |
tgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2816925 |
tgttatatgcaggggctgagattcgaactccggacaccc |
2816963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 218 - 265
Target Start/End: Original strand, 10455765 - 10455812
Alignment:
| Q |
218 |
aacatccattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
||||| ||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
10455765 |
aacatgcattgttatatgcaggggccggggttcgaaccccggacaccc |
10455812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 17751408 - 17751362
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||||||||||||| || ||||||||||| |||||||||| |
|
|
| T |
17751408 |
acatgcattgttatatgcaggagcagaggttcgaaccccggacaccc |
17751362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 20858454 - 20858408
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
20858454 |
acatgcattgttatatgcaggggttggggttcgaattccggacaccc |
20858408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000006; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 42271079 - 42271038
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
42271079 |
cattgttatatgcaggggccggggttcgaactccggacaccc |
42271038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 218 - 265
Target Start/End: Original strand, 19137642 - 19137689
Alignment:
| Q |
218 |
aacatccattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
19137642 |
aacatgcattgttatatgcaggggccgaggttcgaaccccagacaccc |
19137689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 4045705 - 4045659
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
4045705 |
acatgcattgttatatgcaggggtcgaggttcgaacttcggacaccc |
4045659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 16874261 - 16874215
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
16874261 |
acatgcattgttatatgcaggggccgaggttcgaaccgcggacaccc |
16874215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 219 - 268
Target Start/End: Original strand, 2903732 - 2903781
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacacccaac |
268 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| ||| ||||| ||||||| |
|
|
| T |
2903732 |
acatacattgttatatgcaggggctggggttcaaaccccggatacccaac |
2903781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Original strand, 33206786 - 33206827
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
33206786 |
cattattatatgcaggggctggggttcgaaccccggacaccc |
33206827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 265
Target Start/End: Original strand, 4860198 - 4860234
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |
|
|
| T |
4860198 |
ttatatgcaggggctgaggttcgaaccccagacaccc |
4860234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 265
Target Start/End: Complemental strand, 28550352 - 28550316
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| |
|
|
| T |
28550352 |
ttatatgcaggggccgaagttcgaactccggacaccc |
28550316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 265
Target Start/End: Complemental strand, 34898800 - 34898764
Alignment:
| Q |
229 |
ttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |
|
|
| T |
34898800 |
ttatatgcaggggctgaggttcgaaccccagacaccc |
34898764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 227 - 265
Target Start/End: Original strand, 962320 - 962358
Alignment:
| Q |
227 |
tgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
962320 |
tgttatatgcaggggttggggttcgaactccggacaccc |
962358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 35813313 - 35813267
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| | |||||||| |
|
|
| T |
35813313 |
acatgcattgttatatgcaggggctcaggttcgaacccaggacaccc |
35813267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 219 - 265
Target Start/End: Original strand, 40384275 - 40384321
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||| |||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
40384275 |
acatgcattattatatgcagcggctggggttcgaactccggacaccc |
40384321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 99 - 156
Target Start/End: Complemental strand, 4059158 - 4059101
Alignment:
| Q |
99 |
tctcacaacatctcttcaaatactcacaatccacttctgtttgctttaacttcgtcct |
156 |
Q |
| |
|
||||||||||||| |||||| | |||||||| || ||||||||||| ||||| ||||| |
|
|
| T |
4059158 |
tctcacaacatcttttcaaaaattcacaatctacctctgtttgcttcaacttagtcct |
4059101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Original strand, 25055 - 25096
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
25055 |
cattattatatgcaggggctggggttcgaaccccggacaccc |
25096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 108427 - 108386
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
108427 |
cattattatatgcaggggctgaggttcaaaccccggacaccc |
108386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 451441 - 451400
Alignment:
| Q |
224 |
cattgttatatgcaggggctgaggttcgaactccggacaccc |
265 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||| |
|
|
| T |
451441 |
cattgttatatgtaggggccggggttcgaactccggacaccc |
451400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 219 - 263
Target Start/End: Complemental strand, 34104 - 34060
Alignment:
| Q |
219 |
acatccattgttatatgcaggggctgaggttcgaactccggacac |
263 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||||| ||||||||| |
|
|
| T |
34104 |
acatgcattgttatatgcaggggccggggttcgaattccggacac |
34060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University