View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_33 (Length: 335)
Name: NF1911_low_33
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 15 - 317
Target Start/End: Complemental strand, 53617280 - 53616978
Alignment:
| Q |
15 |
aatatacaccaaatgatgcgcttctaatattgcgtgacaaatatcttcccaacatttcccctgctgaaactcaacaccatcatccaattcaatctccggt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53617280 |
aatatacaccaaatgatgcgcttctaatattgcgtgacaaatatcttcccaacatttcccctgctgaaactcaacaccatcatccaattcaatctccggt |
53617181 |
T |
 |
| Q |
115 |
aacatcgaatccggaacgtgtgcatcttgatacagcgtcaccgatcctcctcgccgaaccggaaaatacgaatcctgaaccgcaaacctatcaggaccgg |
214 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53617180 |
aacatcgaatctggaacgtgtgcatcttgatacagcgtcaccgatcctcctcgccgaaccggaaaatacgaatcctgaaccgcaaacctatcaggaccgg |
53617081 |
T |
 |
| Q |
215 |
gaataacgccggaacgatacataggattttcatcgcatctcgtgaatttcatttcgagaaaaacagcgcaatcaggttttggaggtttaccgaatgaacc |
314 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53617080 |
gaataacaccggaacgatacataggattttcatcgcatctcgtgaatttcatttcgagaaaaacagcgcaatcaggttttggaggtttaccgaatgaacc |
53616981 |
T |
 |
| Q |
315 |
tat |
317 |
Q |
| |
|
||| |
|
|
| T |
53616980 |
tat |
53616978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University