View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_37 (Length: 327)
Name: NF1911_low_37
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 18 - 320
Target Start/End: Original strand, 49163124 - 49163426
Alignment:
| Q |
18 |
cctgttcctaaatcaccatgtgcatgacatgcaccaagtagaacctcacatgagttggtcttatctctacttgtcttcgaatacttcttagctaaacttt |
117 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
49163124 |
cctgttcccaaatcaccatgtgcatggcatgcaccaagtagaacctcacatgagttggtcttatctctacttgtctttgaatacttcctagctaaacttt |
49163223 |
T |
 |
| Q |
118 |
gagcttcggctacatatccgcctcgaccaagcatatccaccatgcatgccacatgatccattccttgtacaagtccatattccaaactcattgattgaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49163224 |
gagcttcggctacatatccgcctcgaccaagcatatccaccatgcatgccacatgatccattccttggacaagtccatattccaaactcattgattgaaa |
49163323 |
T |
 |
| Q |
218 |
gaaagcaaagccttcatcaataagccccaaatggctgcaagtcattaacagccctgtgaaggttacttcatcaggtcttacaccagatgccaccatttct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49163324 |
gaaagcaaagccttcatcaataagccccaaatggctgcaagtcattagcagccctgtgaaggttacttcatcaggtcttacaccagatgccaccatttct |
49163423 |
T |
 |
| Q |
318 |
ctg |
320 |
Q |
| |
|
||| |
|
|
| T |
49163424 |
ctg |
49163426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University