View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_38 (Length: 324)
Name: NF1911_low_38
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 268
Target Start/End: Original strand, 3532175 - 3532424
Alignment:
| Q |
13 |
cagaagaaaagtgaaataatgtgattgatgcaggagctatttttggggagattctctacnnnnnnnncgtaaaaattatattcttactttgtctttattt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
3532175 |
cagaagaaaagtgaaataatgtgattgatgcaggagctatttttggggagattctctacttttttttcatcaaaattatattcttactttgtctttattt |
3532274 |
T |
 |
| Q |
113 |
gatccatatctgtcaaatcttaattactcttcaaagagagtctttttgagttgctttagagagtttaagggatgcaattgtgacaatatataccactatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3532275 |
gatccatatctgtcaaatcttaattactcttcaa--agagtctttttgagttgctttagagagtttaagggatgcaattgtgaca----ataccactatc |
3532368 |
T |
 |
| Q |
213 |
ctttaattgttccataataatttcaaaattacgttgacaatcaaaatgaatgaata |
268 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3532369 |
ctataattgttccataataatttcaaaattacgttgacaatcaaaatgaatgaata |
3532424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 273 - 313
Target Start/End: Original strand, 3532498 - 3532538
Alignment:
| Q |
273 |
tttttaagatgggtattaaacacatatgaatgtagtttttg |
313 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3532498 |
tttttaagatgggtattaaacacatatgatagtagtttttg |
3532538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University