View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_48 (Length: 265)
Name: NF1911_low_48
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 10072539 - 10072482
Alignment:
| Q |
18 |
agttgaaccggtctatcattcgaatctcaatatgtaaaatgtttatgaattcttttac |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10072539 |
agttgaaccggtctatcattcgaatctcaatatgtaaaatgtttatgaattcttttac |
10072482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 135 - 252
Target Start/End: Complemental strand, 10072422 - 10072305
Alignment:
| Q |
135 |
ggttagaaatatgagtttaattatcatatatcgatacttgtcaatttnnnnnnnnnnnnnnnnngatatattgttagtgttagcaaatttatacttacat |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10072422 |
ggttagaaatatgagtttaattatcatatatcgatacttatcaatttttcttcttcttcttcttgatatattgttagtgttggcaaatttatacttacat |
10072323 |
T |
 |
| Q |
235 |
cacatataacttagagaa |
252 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
10072322 |
cacatacaacttagagaa |
10072305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University