View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1911_low_48 (Length: 265)

Name: NF1911_low_48
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1911_low_48
NF1911_low_48
[»] chr8 (2 HSPs)
chr8 (18-75)||(10072482-10072539)
chr8 (135-252)||(10072305-10072422)


Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 10072539 - 10072482
Alignment:
18 agttgaaccggtctatcattcgaatctcaatatgtaaaatgtttatgaattcttttac 75  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10072539 agttgaaccggtctatcattcgaatctcaatatgtaaaatgtttatgaattcttttac 10072482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 135 - 252
Target Start/End: Complemental strand, 10072422 - 10072305
Alignment:
135 ggttagaaatatgagtttaattatcatatatcgatacttgtcaatttnnnnnnnnnnnnnnnnngatatattgttagtgttagcaaatttatacttacat 234  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||                 ||||||||||||||||| ||||||||||||||||||    
10072422 ggttagaaatatgagtttaattatcatatatcgatacttatcaatttttcttcttcttcttcttgatatattgttagtgttggcaaatttatacttacat 10072323  T
235 cacatataacttagagaa 252  Q
    |||||| |||||||||||    
10072322 cacatacaacttagagaa 10072305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University