View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1911_low_53 (Length: 256)

Name: NF1911_low_53
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1911_low_53
NF1911_low_53
[»] chr8 (1 HSPs)
chr8 (1-86)||(27802791-27802877)


Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 27802791 - 27802877
Alignment:
1 aacataaatttaaaatattcacttaatacctaagaatacaacttaacatc-nnnnnnnatttgtgttctcctccttaagtatttcac 86  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||    
27802791 aacataaatttaaaatattcacttaatacctaagaatacaacttaacatcttttttttatttgtgttctcctccttaagtatttcac 27802877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University