View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_58 (Length: 249)
Name: NF1911_low_58
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_58 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 6 - 249
Target Start/End: Original strand, 18040050 - 18040293
Alignment:
| Q |
6 |
ctcgaagaatattcagaatcaaacaacaatgcaaagagcgtaaaatccttgacatgtcagataaaagacatggcattgaaagcttcaggtgtatacaaaa |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18040050 |
ctcgaagaagattcagaatcaaacaacaatgcaaagagcgtaaaatctttgacatgtcagataaaagacatggcattgaaagcttcaggtgtatacaaaa |
18040149 |
T |
|
| Q |
106 |
gctgtaatccttgtactcctgcaacccgcctccgaaacggtggctccgagtcagaagtttctgactcggagaagtttcggaggacgaggacatgggggaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18040150 |
gctgtaatccttgtactcctgcaacccgcctccgaaacggtggctccgagtcagaagtttctgactcggagaagtttcggaggacgaggacgtgggggaa |
18040249 |
T |
|
| Q |
206 |
ggagatggaagctaggttgaaggggatatcaagtggagaaggga |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18040250 |
ggagatggaagctaggttgaaggggatatcaagtggagaaggga |
18040293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University