View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_61 (Length: 243)
Name: NF1911_low_61
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 2 - 133
Target Start/End: Original strand, 13695455 - 13695586
Alignment:
| Q |
2 |
tcacggcctcttaaagttaaaactatacctatactacaccaaggtcaacaatctaaataggttgtagtttaaaattatacaggacaaatcacaattacaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
13695455 |
tcacggcctcttaaagttaaaactatacctatactacaccaaggtcaacaatctaaataggttgtagttaaaaattatgcaggacaaatcacaattacaa |
13695554 |
T |
|
| Q |
102 |
attcacgagtctttgtcgaaatagagtatctg |
133 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |
|
|
| T |
13695555 |
attcacgaatctttgtcgaaatagagtatctg |
13695586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 196 - 227
Target Start/End: Original strand, 13695649 - 13695680
Alignment:
| Q |
196 |
gcatggagtttcataacggtttacgagagcat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13695649 |
gcatggagtttcataacggtttacgagagcat |
13695680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University