View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_66 (Length: 239)
Name: NF1911_low_66
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 112 - 221
Target Start/End: Original strand, 38516708 - 38516817
Alignment:
| Q |
112 |
ttgatgagtaaatgcaatagtgtggtctcgtttcctatttaatgatgagattgaggagagatgatggatctctatattaaggcacttccacggtagctaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38516708 |
ttgatgagtaaatgcaatagtgtggtctcgtttcctatttaatgatgagattgaggagagatgatggatctctatattaaggcacttccacggtagctaa |
38516807 |
T |
 |
| Q |
212 |
acgtcattat |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
38516808 |
acgtcattat |
38516817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University