View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_67 (Length: 239)
Name: NF1911_low_67
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_67 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 1605302 - 1605205
Alignment:
| Q |
1 |
ctcttgtcttagagtgttatgagatgtagttaggtattttctttggatgttttgtgtatattgtggctgttggtgtttgagaataatctatatgttgt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1605302 |
ctcttgtcttagagtgttatgagatgtagttaggtattttctttgggtgttgtgtgtatattgtggctgttggtgtttgagaataatctatatgttgt |
1605205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 2 - 98
Target Start/End: Complemental strand, 18780034 - 18779939
Alignment:
| Q |
2 |
tcttgtcttagagtgttatgagatgtagttaggtattttctttggatgttttgtgtatattgtggctgtt-ggtgtttgagaataatctatatgttgt |
98 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||| || ||||| ||||||| | ||| ||||||||||||||||||||||||||| |
|
|
| T |
18780034 |
tcttgtcttagagtgttgtgagatgtagttagatattttctttgg--gtgatgtgtgtattgtgaccgttaggtgtttgagaataatctatatgttgt |
18779939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 25078304 - 25078350
Alignment:
| Q |
1 |
ctcttgtcttagagtgttatgagatgtagttaggtattttctttgga |
47 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||| ||||||| |
|
|
| T |
25078304 |
ctcttgtcttagagtgttgtgagatgtaattaggtatttgctttgga |
25078350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 3289717 - 3289763
Alignment:
| Q |
1 |
ctcttgtcttagagtgttatgagatgtagttaggtattttctttgga |
47 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3289717 |
ctcttttcttagagtgttgtgagatgtagttaggtattttctttgga |
3289763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 14437262 - 14437218
Alignment:
| Q |
1 |
ctcttgtcttagagtgttatgagatgtagttaggtattttctttg |
45 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||| ||||| |
|
|
| T |
14437262 |
ctcttgtcttaaagtgttgtgagatgtagttaggtatttactttg |
14437218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University