View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_78 (Length: 231)
Name: NF1911_low_78
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 16 - 118
Target Start/End: Original strand, 41845420 - 41845522
Alignment:
| Q |
16 |
aatattactagatcccccacttgaatcagcaataatgacagaagaaatctttggccctgtgcttcccataataactgtaagatatatatctgcaacataa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41845420 |
aatattactagatcccccacttgaatcagcaataatgacagaagaaatctttggccctgtgcttcccataataactgtaagatatatatctgcaacataa |
41845519 |
T |
|
| Q |
116 |
ttt |
118 |
Q |
| |
|
||| |
|
|
| T |
41845520 |
ttt |
41845522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University