View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_80 (Length: 228)
Name: NF1911_low_80
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_80 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 25 - 213
Target Start/End: Complemental strand, 33250688 - 33250500
Alignment:
| Q |
25 |
catgtcacaaaaacattcttgcaggagaaggtttatggtttggaggagttgcaggacatgttcatggaaatggctgaaggattccagagtccttcaatgt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33250688 |
catgtcacaaaaacattcttgcaggagaaggtttatggtttggaggagttgcaggacatgttcatggaaatggctgaaggattccagagtccttcagtgt |
33250589 |
T |
 |
| Q |
125 |
attgtgggacaccatcggtggttgatgaatcctttgctaacagaggaagtgttttgacacgataattgataatataagccggcccatat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33250588 |
attgtgggacaccatcggtggttgatgaatcctttgctaacagaggaagtgttttgacacgataattgataatataagccgggccatat |
33250500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University