View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1911_low_82 (Length: 214)

Name: NF1911_low_82
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1911_low_82
NF1911_low_82
[»] scaffold0406 (1 HSPs)
scaffold0406 (18-51)||(1781-1814)
[»] chr6 (1 HSPs)
chr6 (18-51)||(25479938-25479971)


Alignment Details
Target: scaffold0406 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0406
Description:

Target: scaffold0406; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 1814 - 1781
Alignment:
18 gaacaggtaaatgggtggggtgtgcttacttaag 51  Q
    ||||||||||||||||||||||||||||||||||    
1814 gaacaggtaaatgggtggggtgtgcttacttaag 1781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 25479938 - 25479971
Alignment:
18 gaacaggtaaatgggtggggtgtgcttacttaag 51  Q
    |||||| |||||||||||||||||||||||||||    
25479938 gaacagataaatgggtggggtgtgcttacttaag 25479971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University