View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_82 (Length: 214)
Name: NF1911_low_82
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_82 |
 | |
|
| [»] scaffold0406 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0406 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0406
Description:
Target: scaffold0406; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 1814 - 1781
Alignment:
| Q |
18 |
gaacaggtaaatgggtggggtgtgcttacttaag |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1814 |
gaacaggtaaatgggtggggtgtgcttacttaag |
1781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 25479938 - 25479971
Alignment:
| Q |
18 |
gaacaggtaaatgggtggggtgtgcttacttaag |
51 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
25479938 |
gaacagataaatgggtggggtgtgcttacttaag |
25479971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University