View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_83 (Length: 210)
Name: NF1911_low_83
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_83 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 16784145 - 16784351
Alignment:
| Q |
1 |
tttttcttgaaatagtttcgtggtcaaaattcccaatttttatcaatttaatggtcttttttagtgttagttacatacaatacaatcttcttgtctctaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16784145 |
tttttcttgaaatagtttcgtggtcaaaattcccaatttttatcaatttaatggt-ttttttagtattagttacatacaatacaatcttcttgtctctaa |
16784243 |
T |
|
| Q |
101 |
aaaatactcgtataactatcataaaataaagatacatttgaatannnnnnnctgtcctaccctaactaaggtatttgaatatatataaggttttgctaga |
200 |
Q |
| |
|
||| |||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
16784244 |
aaagtactggtataactatcataaaataaagatatatttgaatatttttttctgtcctaccctaactaaggtatttga--atatataaagttttgctaga |
16784341 |
T |
|
| Q |
201 |
agacaccttt |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
16784342 |
agacaccttt |
16784351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University