View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1911_low_84 (Length: 209)
Name: NF1911_low_84
Description: NF1911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1911_low_84 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 5 - 194
Target Start/End: Original strand, 18040505 - 18040694
Alignment:
| Q |
5 |
aattcttgatcagattatatttatctcattactcagctctgcgcactgagaatccaaaagttagcatggaaaaaattactgtgtcttgttannnnnnnnn |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
18040505 |
aattcttgatcagattatatttatctcattactcagctctgcgcaatgagaatccaaaagttagcatggaaaaaattaccgtgtcgtgttatttttttac |
18040604 |
T |
|
| Q |
105 |
nnnnnnnnnnnnnacaatttagtattcggtccaaatatcgactagatcagagatcaatctcatcgtccactggcataggtgtattggttt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18040605 |
tattttttattttacaatttagtattcggtccaaatatcgactaggtcagagatcaatctcatcgtccactggcataggtgtattggttt |
18040694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University