View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19120_high_11 (Length: 239)

Name: NF19120_high_11
Description: NF19120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19120_high_11
NF19120_high_11
[»] chr1 (1 HSPs)
chr1 (22-187)||(6376998-6377165)


Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 22 - 187
Target Start/End: Original strand, 6376998 - 6377165
Alignment:
22 tcccaaaattaacgacccatttcatttttcaatgcaacattaannnnnnnn-aattataactttaattaatattaaatgcattaatactctcaaaaacca 120  Q
    ||||||||||||||||| |||| ||||||||||||||||||||         ||||||||||||||||||||||||||||| ||||||||||  ||||||    
6376998 tcccaaaattaacgaccaatttaatttttcaatgcaacattaatttttttttaattataactttaattaatattaaatgcactaatactctcggaaacca 6377097  T
121 ttcttatctttcttacacttatac-nnnnnnnttcttagtatacgtgaaatggtattggagagagtag 187  Q
    ||||||||||||||||||||| ||        ||||||||||||||||||||||||||||||||||||    
6377098 ttcttatctttcttacacttacacaaaaaaaattcttagtatacgtgaaatggtattggagagagtag 6377165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University