View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19120_high_11 (Length: 239)
Name: NF19120_high_11
Description: NF19120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19120_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 22 - 187
Target Start/End: Original strand, 6376998 - 6377165
Alignment:
| Q |
22 |
tcccaaaattaacgacccatttcatttttcaatgcaacattaannnnnnnn-aattataactttaattaatattaaatgcattaatactctcaaaaacca |
120 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
6376998 |
tcccaaaattaacgaccaatttaatttttcaatgcaacattaatttttttttaattataactttaattaatattaaatgcactaatactctcggaaacca |
6377097 |
T |
|
| Q |
121 |
ttcttatctttcttacacttatac-nnnnnnnttcttagtatacgtgaaatggtattggagagagtag |
187 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6377098 |
ttcttatctttcttacacttacacaaaaaaaattcttagtatacgtgaaatggtattggagagagtag |
6377165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University