View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19120_low_13 (Length: 237)
Name: NF19120_low_13
Description: NF19120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19120_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 35042550 - 35042336
Alignment:
| Q |
1 |
aaacaggataaatatatcaatataaaatcaagtgcaataattatgaatggccacatttgcttagttatgaacaatt-----gatttgactcatagcaaac |
95 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
35042550 |
aaacatgataaatatatcaatataaaagcaagtgcaataattatgaatggccacatttgcttagttatgaacaattatattgacttgactcatagcaaac |
35042451 |
T |
 |
| Q |
96 |
ttcatgtgtgaattgtgattggttcaatgtttcccact--------acgtcccaatgttcttttcac--tgatttcaagaagcaacaaagacaaaatgta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35042450 |
ttcatgtgtgaattgtgattggttcaatgtttcccactgcaatctcacgtcccaatgttcttttcactgtgatttcaagaagcaacaaagacaaaatgta |
35042351 |
T |
 |
| Q |
186 |
aaaactcaccgttgt |
200 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
35042350 |
aaaactcactgttgt |
35042336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University