View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19120_low_9 (Length: 250)
Name: NF19120_low_9
Description: NF19120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19120_low_9 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 116 - 250
Target Start/End: Original strand, 39921019 - 39921153
Alignment:
| Q |
116 |
atttggtttagcttttcactagagttataagttggagttgagcttttctgaaagcaaactatcatattgcaaatgcaaaggctttgtggataggcatgca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39921019 |
atttggtttagcttttcactagagttataagttggagttgagcttttgtgaaaagaaactatcatattgcaaatgcaaaggctttgtggataggcatgca |
39921118 |
T |
|
| Q |
216 |
taaaagtatgagaggcaaaaagagattttagccca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39921119 |
taaaagtatgagaggcaaaaagagattttagccca |
39921153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 10 - 120
Target Start/End: Original strand, 39920207 - 39920317
Alignment:
| Q |
10 |
agatgaaggaatttggtcggtgacttctcacggttttcttttgaaccttttataagaagttatatatatggtattttggattgaagtattgaaccattgt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39920207 |
agatgaaggaatttggtcggtgacttctcacggttttcttttgaaccttttataagaagttatatatgtggtattttggattgaagtattgaaccattgt |
39920306 |
T |
|
| Q |
110 |
gcctatatttg |
120 |
Q |
| |
|
||||||||||| |
|
|
| T |
39920307 |
gcctatatttg |
39920317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University