View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19122_low_29 (Length: 261)
Name: NF19122_low_29
Description: NF19122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19122_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 253
Target Start/End: Original strand, 2458551 - 2458782
Alignment:
| Q |
20 |
aatgaaacttttaatgaagaagtatatatgtgtcaaccacctgtttttgtgtatcaaatatacatacgatctaattatgtttgcatgcttcaaaggtctc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||| |
|
|
| T |
2458551 |
aatgaaacttttaatgaagaagtatatatgtctcaaccacctgtttttgtgtatcaaatatacatac--tctaattatatttgcatgcttcaaaagtctc |
2458648 |
T |
|
| Q |
120 |
tttatggcctcaaggaagctccaaatgcatacactaatatatatgtggccataaagacaatattaattgtggcctattttgttgtctatgttgatgattt |
219 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2458649 |
tttatggcctcaacgaagctccaaatgcatacactaatatatatgtggccataaagacaatattaattgtggcctattttgttgtctatgttgatgattt |
2458748 |
T |
|
| Q |
220 |
acttttcaacggtaactccttcaattttcatctc |
253 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
2458749 |
acttttcaacggtaacaccttcaattttcatctc |
2458782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University