View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19122_low_30 (Length: 260)
Name: NF19122_low_30
Description: NF19122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19122_low_30 |
 |  |
|
| [»] scaffold0054 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0054 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 242
Target Start/End: Complemental strand, 38401 - 38176
Alignment:
| Q |
15 |
gagtgcctttgttgttctggaaagctgttgtggacgtcaagtgcggttttgtggggtgtattggaagttttgataatgacgaaagagtatgagcggaagg |
114 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38401 |
gagtgcctttgttgttttggaaagctcttgtggacgtcaagtgcggttttgtggggtgtattggaagttttgataatgacgaaagagtatgagcggaagg |
38302 |
T |
 |
| Q |
115 |
gatccaacaccaaaattcatctcagtgagttcttcaaatgcttgtgaagattgcgtagaccaatattatcgacgacattggtaaacataacctaaacagt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38301 |
--tccaacaccaaaattcatctcagtgagttcttcaaatgcttgtgaagattgcgtagaccaatattatcgacgacattggtaaacataacctaaacagt |
38204 |
T |
 |
| Q |
215 |
aaattggaaacaaacacaaattaaaact |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38203 |
aaattggaaacaaacacaaattaaaact |
38176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University