View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19122_low_33 (Length: 257)
Name: NF19122_low_33
Description: NF19122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19122_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 6 - 242
Target Start/End: Complemental strand, 25209586 - 25209338
Alignment:
| Q |
6 |
aggagcacagattgttaacgaaaaaagaggaaagatcgcgtaattagttaatgtgtcacatcacaatctctaacggcaaaagctaaacgagagattgttt |
105 |
Q |
| |
|
|||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
25209586 |
aggatcacaaattgttaacaaaaaaagaggaaagatcgcgtaattagttaatgtgtcacatcacaatctctaacggcaaaagctaaacaagagactgttt |
25209487 |
T |
 |
| Q |
106 |
tgattagtacttcataatttcatcggcgtagttgtcaa-ttacaaaaatcatggactattctgatcaatgattacattttcgaggatcaact-------- |
196 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25209486 |
tgattagtacttcataatttcatcgggatagttgtcaatttacaaaaatcatggactattttgatcaatgattacattttcgaggatcaacttctgtatt |
25209387 |
T |
 |
| Q |
197 |
---tcaatgaaaacatttttcagggttgagaattgtgtatgatattttt |
242 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25209386 |
cactcaatgaaaacatttttaagggttgagaattgtgtatgatattttt |
25209338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University