View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19123_high_10 (Length: 357)
Name: NF19123_high_10
Description: NF19123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19123_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 26511567 - 26511448
Alignment:
| Q |
8 |
gatttttcaatatttctattatcttataacatgcaacaaaacaaaacaaatcacatccacgtctctagttgtttcttctatttttgatataccaagtgtg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26511567 |
gatttttcaatatttctattatcttataacatgcaacaaaacaaaacaaatcacatccacgtctctagttgtttcttctatttttgatataccaagtgtg |
26511468 |
T |
|
| Q |
108 |
acacataatggagaatcaac |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26511467 |
acacataatggagaatcaac |
26511448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 204 - 341
Target Start/End: Complemental strand, 26511370 - 26511233
Alignment:
| Q |
204 |
tttcttctttagcatatacttacatgttccaactcagaaacccacatgggaatgctacattattatcatcacttcacaatctaagacaatctaactgtgt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| || ||||||||||| ||| |
|
|
| T |
26511370 |
tttcttctttagcatatacttacatgttccaactcagaaacccacatgggtatcctacattattatcatcacttcacaatccaacacaatctaactctgt |
26511271 |
T |
|
| Q |
304 |
gttcgtgcagtctttttgctttcttttatattcctaaa |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26511270 |
gttcgtgcagtctttttgctttcttttatattcctaaa |
26511233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University