View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19123_high_23 (Length: 248)
Name: NF19123_high_23
Description: NF19123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19123_high_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 7553677 - 7553430
Alignment:
| Q |
1 |
tagcagccctcatatgataatactcaagaaattagcacctcatttttatagctgacaggcttttgaaataaaaggagtccacatgactacatgctttcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7553677 |
tagcagccctcatatgataatactcaagaaattagcacctcatttttatagctaacaggcttttgaaataaaaggagtccacatgactacatgctttcaa |
7553578 |
T |
 |
| Q |
101 |
aatctctaactacagttctgccagtttcttctgtgcatcttttgcaacattttaaaggccaaaaatattccaccatattggcatacatgctacattaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7553577 |
aatctctaactacagttctgccagtttcttctgtgcatcttttgcaacattttaaaggccaaaattattccaccatattggcatacatgctacattaact |
7553478 |
T |
 |
| Q |
201 |
tgtataaaaactactaatatactttaaaattcttttacctttgctact |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
7553477 |
tgtataaaaactactaatatactttaaaactcttttacctttgttact |
7553430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University