View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19123_high_28 (Length: 219)
Name: NF19123_high_28
Description: NF19123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19123_high_28 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] scaffold0174 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 23476574 - 23476356
Alignment:
| Q |
1 |
ttttgtgctgaacttgttggtatattaatcaatttgtgtatggatccctattcccttgtggtttcatgttcttgatcataaaggttgaagcgccactttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23476574 |
ttttgtgctgaacttgttggtatattaatcaatttgtgtatggatccctattcccttgtggtttcatgttcttgatcataatggttgaagcgccactttc |
23476475 |
T |
|
| Q |
101 |
tccaagcagaatacgcttcaccgccaaaataattttcattcccgtttctctttcccctttctgcagtagctactcgattttcatggttgagtcatatgaa |
200 |
Q |
| |
|
|||||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23476474 |
tccaagcataatacgctttaccgccaaaagaattttcattcccgtttctctttcccctttctgcagtagctgctcgattttcatggttgagtcatatgaa |
23476375 |
T |
|
| Q |
201 |
agaaacataagaagaacaa |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
23476374 |
agaaacataagaagaacaa |
23476356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0174 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0174
Description:
Target: scaffold0174; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 162 - 216
Target Start/End: Complemental strand, 22920 - 22864
Alignment:
| Q |
162 |
tgcagtagctactcgattttcatg--gttgagtcatatgaaagaaacataagaagaa |
216 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| |||||||| |||||||||| |
|
|
| T |
22920 |
tgcagtagccactcgattttcatgattttgagtcataagaaagaaagataagaagaa |
22864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University