View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19123_low_22 (Length: 260)
Name: NF19123_low_22
Description: NF19123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19123_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 23 - 176
Target Start/End: Original strand, 12834565 - 12834719
Alignment:
| Q |
23 |
cccacagacacagatatatatgcacacacatgcaagtggtggattgtcacctctctgaagcttgtttatgcaaaagtggctggcctaacaaacgacaaat |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12834565 |
cccacagacacagatatatatgcacacacatgcaagtggtggattgtcacctctctgaagcttgtttatgcaaaaatggctggcctaacaaacgacaaat |
12834664 |
T |
 |
| Q |
123 |
gaaaatgg-ttttttaaattgggttaaataaattattagtccttctaaatgttac |
176 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12834665 |
gaaaatggttttttttaattgggttaaataaattattagtccttctaaatgttac |
12834719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University