View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19125_high_5 (Length: 374)

Name: NF19125_high_5
Description: NF19125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19125_high_5
NF19125_high_5
[»] chr4 (1 HSPs)
chr4 (16-357)||(52120142-52120483)


Alignment Details
Target: chr4 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 16 - 357
Target Start/End: Original strand, 52120142 - 52120483
Alignment:
16 atgatcaagctcaaacaaatccgaactcgaacaactcaaagcatcatcatcttcatcttcatcgtcatcttcaccgttatcataaaatctttctttagcc 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52120142 atgatcaagctcaaacaaatccgaactcgaacaactcaaagcatcatcatcttcatcttcatcgtcatcttcaccgttatcataaaatctttctttagcc 52120241  T
116 ataacaaccttgttaatattcttcagctcattaaccgaagaatttctcgtaatctttcgaatagtactaggttgatgttgttgttcagaatcctcaccta 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52120242 ataacaaccttgttaatattcttcagctcattaaccgaagaatttctcgtaatctttcgaatagtactaggttgatgttgttgttcagaatcctcaccta 52120341  T
216 ggattacgctaacaggatagaatctaaccgatcttttaacaccattgttggactttgaagttgttttactcatgcaagaccttctagaatatgaagaaac 315  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52120342 ggattacgctaacaggatagaatctaaccgatcttttaacaccattgttggactttgaagttgttttactcatgcaagaccttctagaatatgaagaaac 52120441  T
316 tgaggaagaaaaacaaggtgattttgatttgtgatcaaaact 357  Q
    ||||||||||||||||||||||||||||||||||||||||||    
52120442 tgaggaagaaaaacaaggtgattttgatttgtgatcaaaact 52120483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University