View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19125_low_11 (Length: 253)
Name: NF19125_low_11
Description: NF19125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19125_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 9 - 244
Target Start/End: Complemental strand, 36640899 - 36640666
Alignment:
| Q |
9 |
gaaatgaactcatttgcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtgaggcttgctag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36640899 |
gaaatgaactcatttgcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtg--gcttgctag |
36640802 |
T |
 |
| Q |
109 |
tttgcaattcaaaatttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36640801 |
tttgcaattcaaaatttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggc |
36640702 |
T |
 |
| Q |
209 |
gtgtttagctgataggtgggattgtgttgatgatgt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36640701 |
gtgtttagctgataggtgggattgtgttgctgatgt |
36640666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 237
Target Start/End: Complemental strand, 36633533 - 36633305
Alignment:
| Q |
9 |
gaaatgaactcatttgcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtgaggcttgctag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
36633533 |
gaaatgaactcatttgcagatgctttagcaaaaagtggcgtgaatatggaggggcagagaatttggtggcctatggattaaagtgtgtgaggcttgctag |
36633434 |
T |
 |
| Q |
109 |
tttgcaattcaaaatttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggc |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36633433 |
tttgcaattcaaaatttattttacagaaatagagaaatctatttgtatatctgtctgtttgctgctgtcctgactgattcggatgctgttgtggtggggt |
36633334 |
T |
 |
| Q |
209 |
gtgtttagctgataggtgggattgtgttg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36633333 |
gtgtttagctgataggtgggattgtgttg |
36633305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University