View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19127_high_15 (Length: 390)
Name: NF19127_high_15
Description: NF19127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19127_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 16 - 380
Target Start/End: Complemental strand, 15097423 - 15097059
Alignment:
| Q |
16 |
tcacaaacataacagggtactctgttctcgtcggcctcgcctccggtctcgaaccggtttgtagccaagctttcggtagcaaaaattgggaacttctttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15097423 |
tcacaaacataacagggtactctgttctcgtcggcctcgcctccggtctcgaaccggtttgtagccaagctttcggtagcaaaaattgggaacttctttc |
15097324 |
T |
 |
| Q |
116 |
cctttcactacaacggatggttctcatacttctaatggcaattgtgcccataagtctcctttggcttaacctggaaaaaatcatgcttttcatgggacaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15097323 |
cctttcactacaacggatggttctcatacttctaatggcaattgtgcccataagtctcctttggcttaaccttgaaaaaatcatgcttttcatgggacaa |
15097224 |
T |
 |
| Q |
216 |
gatggtaaaatcactgaaatggcagcaatatattgtttctattcactacctgatcttttgacaaatactttgttacaacctttgagagtgtttttaaggt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15097223 |
gatggtaaaatcactgaaatggcagcaatatattgtttctattcactacctgatcttttaacaaatactttgttacaacctttgagagtgtttttaaggt |
15097124 |
T |
 |
| Q |
316 |
cacaaaaagtgacaaaacccatgatgtattgctcccttatagcagttctttttcatgtgcctttg |
380 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15097123 |
cacaaaaagtgacaaaacctatgatgtattgctcccttatagcagttctttttcatgtgcctttg |
15097059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University