View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19127_high_25 (Length: 295)
Name: NF19127_high_25
Description: NF19127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19127_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 21 - 285
Target Start/End: Original strand, 41941308 - 41941572
Alignment:
| Q |
21 |
tatgcatttgctaggtcgcaatatggagagtgatagtgcatgtgtatgtgtgcatagaatgagagagatttaactgtctggaatatgattctgagtttag |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41941308 |
tatgcatttgctaggtcgcaatatggagagtgatagtgcatgtgtatgtgtgcatagaatgagagagattttactgtctggaatatgattctgagtttag |
41941407 |
T |
 |
| Q |
121 |
acaagcacttgtaacgcttagatgaagtgttagtgtcagtgagagtaaagatggaccactgatacatgctgctgcttttggtgtttcactcaaatggtat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41941408 |
acaagcacttgtaacgcttagatgaagtgttagtgtcagtgagagtaaagatggaccactgatacatgctgctgcttttggtgtttcactcaaatggtat |
41941507 |
T |
 |
| Q |
221 |
tcttttgccttttcagaacaactacaaacagttcctatatgaaacattttcagtcagggtctctg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41941508 |
tcttttgccttttcagaacaactacaaacagttcctatatgaaacattttcagtcagggtctctg |
41941572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University