View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19127_high_37 (Length: 240)
Name: NF19127_high_37
Description: NF19127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19127_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 25 - 180
Target Start/End: Complemental strand, 13255879 - 13255724
Alignment:
| Q |
25 |
tcatcattttagtcgttgaatgaatgagaattgagatcattataataattatatatttacatttacacaggctgttgttgaaacgggacacaagttcagg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
13255879 |
tcatcattttagtcgttgaatgaatgagaattgaaatcattattataattatatatttacatttacacaggctgttatagaaacgggacacaagttcagg |
13255780 |
T |
 |
| Q |
125 |
gagaccattcttgctcttggaggtggcaagccaccacttgaggtgagaattgagat |
180 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13255779 |
gaaaccattcttgctcttggaggtggcaagccaccactcgaggtgagaattgagat |
13255724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University