View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19127_high_44 (Length: 201)
Name: NF19127_high_44
Description: NF19127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19127_high_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 43 - 186
Target Start/End: Original strand, 30756934 - 30757077
Alignment:
| Q |
43 |
gaagtagtaaggaaacagtaattaggcaaaccgtagcggccctgaaaaagtctctcctaataggtaacagttgcatattcccgtaatatcattggcgaat |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30756934 |
gaagtagtaaggaaacagtaattaggcaaaccgtagcagccctgaaaaagtctctcctaataggaaacagttgcatattcccgtaatatcattggcgaat |
30757033 |
T |
 |
| Q |
143 |
agatgatggtgaacgtgaaccctttgagcggggttggatatgct |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757034 |
agatgatggtgaacgtgaaccctttgagcggggttggatatgct |
30757077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University