View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19127_low_20 (Length: 364)
Name: NF19127_low_20
Description: NF19127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19127_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 354
Target Start/End: Complemental strand, 15097058 - 15096702
Alignment:
| Q |
1 |
aattacttcttggttatggtgatgcaatttggagtaccgggcgtggcgatggcgtccgtgttaacgaatatgaacatggttgtattgatggcggggtatg |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
15097058 |
aattatttcttggttatggtgatgcaatttggtgtaccgggcgtggcgatggcgtccgtgttaacgaatatgaacatggtcgtgttgatggcggggtatg |
15096959 |
T |
 |
| Q |
101 |
tcggcttgtttaggaagaaggagatgatgttaaagtggcccggctg---cggcggtggcggagggatgatggttgtgagtgaaggtttgggggagttgat |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||| || || |||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
15096958 |
tcgggttgtttaggaagaaggagatgatgttaaaatggccgggttgtggcggcggtggcggagggatgatggtggttagtgaaggtttgggggagttgat |
15096859 |
T |
 |
| Q |
198 |
gaaattggctgtacctagttgtcttatgatatgtttggaatggtggtggtatgagattgttactgttttggctggttatttggagaatcctacattggct |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15096858 |
gaaattggctgtacctagttgtcttatgatatgtttggaatggtggtggtatgagattgttactgttttggctggttatttggagaatcctacattggct |
15096759 |
T |
 |
| Q |
298 |
gttgctgctactgggattttgattcagacaactagtatgatgtatactgtccctatg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15096758 |
gttgctgctactgggattttgattcagacaactagtatgatgtatactgtccctatg |
15096702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University