View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19127_low_21 (Length: 362)
Name: NF19127_low_21
Description: NF19127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19127_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 222 - 345
Target Start/End: Original strand, 35696696 - 35696819
Alignment:
| Q |
222 |
tgttatatatacagtgcttgcttcatggtttaggctcaaatatcctcacttggccattggtgctttggcctcatctgctccaatcctctactttgatgat |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696696 |
tgttatatatacagtgcttgcttcatggtttaggctcaaatatcctcacttggccattggtgctttggcctcatctgctccaatcctctactttgatgat |
35696795 |
T |
|
| Q |
322 |
attacatcaccaaatgcttatttc |
345 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35696796 |
attacatcaccaaatgcttatttc |
35696819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 233 - 308
Target Start/End: Original strand, 32478404 - 32478479
Alignment:
| Q |
233 |
cagtgcttgcttcatggtttaggctcaaatatcctcacttggccattggtgctttggcctcatctgctccaatcct |
308 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32478404 |
cagtgcttgcttcatggtttcagttaaaatatcctcacttggccattggtgttttggcctcatctgctccaatcct |
32478479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University