View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19127_low_23 (Length: 328)
Name: NF19127_low_23
Description: NF19127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19127_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 62 - 313
Target Start/End: Original strand, 9840381 - 9840629
Alignment:
| Q |
62 |
aaacagaggaacgcgactagaaagggacagacgccgtacggttgccgggacggcggcagcgggtgagcttcttgcagtcctccttcctgatgtttcttct |
161 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9840381 |
aaacagaagaacgcgactagaaagggccagacgccgtacggttgccgggacggcggcagcgggtgagcttcttgcagtcctccttcctgatgtttcttct |
9840480 |
T |
 |
| Q |
162 |
ttaggtatcactcactctctgttctttaatgttgttattattcaattcttgtatcataatgtaataatcattttcaatattaataatcaccactattagt |
261 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9840481 |
ttaggtatcactcactctctgttcttcaatgttgttattattcaattcttgtatcataatg---taatcattttcaatattaataatcaccactattagt |
9840577 |
T |
 |
| Q |
262 |
agtaccattaatcaaatttagattcagggatcaaaaaccaaaccaaacaatt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9840578 |
agtaccattaatcaaatttagattcagggatcaaaaaccaaaccaaacaatt |
9840629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 16 - 62
Target Start/End: Original strand, 9840313 - 9840357
Alignment:
| Q |
16 |
atatataatcaaagttcttttttccgggtagagagtaagacattaga |
62 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9840313 |
atatataatgaaagttcttttttccgggt--agagtaagacattaga |
9840357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University