View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19127_low_31 (Length: 286)
Name: NF19127_low_31
Description: NF19127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19127_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 122 - 271
Target Start/End: Original strand, 12868017 - 12868166
Alignment:
| Q |
122 |
ttaattatgttggtgcagggtaaaccaataaacgacattaggaagaaaagttggtggtttatcaaggttcatttttatcaatatagttgagctagatact |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | | |
|
|
| T |
12868017 |
ttaattatgttggtgcagggtaaaccaataaacgacattaggaagaaaagttggtggtttatctaggttcatttttatcaatatagttgagctagaaaat |
12868116 |
T |
 |
| Q |
222 |
cttagtgttggctggaatttgtgaaggtttgtgacttgaaagggggtgat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12868117 |
cttagtgttggctggaatttgtgaaggtttgtgacttgaaagggggtgat |
12868166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 126 - 154
Target Start/End: Original strand, 49744564 - 49744592
Alignment:
| Q |
126 |
ttatgttggtgcagggtaaaccaataaac |
154 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49744564 |
ttatgttggtgcagggtaaaccaataaac |
49744592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University