View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19127_low_39 (Length: 249)
Name: NF19127_low_39
Description: NF19127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19127_low_39 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 35 - 249
Target Start/End: Complemental strand, 13256099 - 13255886
Alignment:
| Q |
35 |
tcttatggtgaatttgtgtgttatgcagtgggctgaagtgctatctgcagatgccttctctgcatttgaggacgcaggattggataataacaaggtactg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
13256099 |
tcttatggtgaatttgtgtgttatgcagtgggctgaagtgctgtctgcagatgctttctctgcatttgaggatgcaggtttggataataacaaggtactg |
13256000 |
T |
|
| Q |
135 |
tatttgattaagaaaaactgtcgataaggattttgcttttctctttagggacatggtctgtctttaatcttcaaaatcctcaatttttcgtaaaatatgc |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13255999 |
tatttgattaagaaaaactgttgataaggattttgcttttctcttcagggacat-gtctgtttttaatcttcaaaatcctcaatttttcgtaaaatatac |
13255901 |
T |
|
| Q |
235 |
agcatagcttatctc |
249 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
13255900 |
agcatagctaatctc |
13255886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University