View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19127_low_48 (Length: 201)

Name: NF19127_low_48
Description: NF19127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19127_low_48
NF19127_low_48
[»] chr5 (1 HSPs)
chr5 (43-186)||(30756934-30757077)


Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 43 - 186
Target Start/End: Original strand, 30756934 - 30757077
Alignment:
43 gaagtagtaaggaaacagtaattaggcaaaccgtagcggccctgaaaaagtctctcctaataggtaacagttgcatattcccgtaatatcattggcgaat 142  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
30756934 gaagtagtaaggaaacagtaattaggcaaaccgtagcagccctgaaaaagtctctcctaataggaaacagttgcatattcccgtaatatcattggcgaat 30757033  T
143 agatgatggtgaacgtgaaccctttgagcggggttggatatgct 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
30757034 agatgatggtgaacgtgaaccctttgagcggggttggatatgct 30757077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University