View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19128_high_44 (Length: 303)
Name: NF19128_high_44
Description: NF19128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19128_high_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 14 - 285
Target Start/End: Complemental strand, 33621990 - 33621714
Alignment:
| Q |
14 |
tagcaaaggatcccaaattttattttgtgaggaggggcacaagagaggaggcaacataaaaggataccaatgaatgattggtgtggaatgttttggtgaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33621990 |
tagcaaaggatcccaaattttattttgtgaggaggggcacacgagaggaggcaacataaaaggataccaatgaatgattggtgtggaatgttttggtgaa |
33621891 |
T |
|
| Q |
114 |
aaccatctctcttctccttgc-----atactttatgtacttcgctgggtgtacttacctcttacattcctgtacttgcaattatcataacatgaaaaggc |
208 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33621890 |
aaccatctctcttctccttgccttgcatactttatgtacttcgctgggtgtacttacctcttacattcctgtacttgcaattatcataacatgaaaaggc |
33621791 |
T |
|
| Q |
209 |
ttgcagccataagaattaagtcctaaaattttgtaatagattcttaaactgtacaatgtcttttgacaatcgagtga |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33621790 |
ttgcagccataagaattaagtcctaaaattttgtaatagattcttaaactgtacaatgtcttttgacaatcgagtga |
33621714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University