View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19128_high_50 (Length: 251)
Name: NF19128_high_50
Description: NF19128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19128_high_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 32504853 - 32504633
Alignment:
| Q |
20 |
caccttattgattaatttgattccgtccaaaaaacaaatttaattgcttttgcatgtgaaaattgtacaggatacggtccattgaaatgtataagattgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32504853 |
caccttattgattaatttgattccgtccaaaaaacaaatttaattgcttttgcatgtgaaaattgtacaggatacggtccattgaaatgtataagattgg |
32504754 |
T |
 |
| Q |
120 |
tgtgtattaatatcatatcattctcttcactcttcagagatcaaaccggcaccaacatgcattatggagctgtcctactctcaaacacgaatttaaggca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32504753 |
tgtgtattaatatcatatcattctcttcactcttcagagatcaaaccggcaccaacatgcattatggagctgtcctactctcaaacacgaatttaaggca |
32504654 |
T |
 |
| Q |
220 |
ggcattttgttcttctttctt |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32504653 |
ggcattttgttcttctttctt |
32504633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University