View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19128_high_59 (Length: 233)
Name: NF19128_high_59
Description: NF19128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19128_high_59 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 15 - 122
Target Start/End: Original strand, 34916013 - 34916120
Alignment:
| Q |
15 |
cagagataataaggcatatccttatgcctctaggaagcctgagaaagttaaaaagaagatcaactttataaaagggcaatggacagtagaagaagatcgg |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34916013 |
cagaaataataaggcatatccttatgcctctaggaagcctgagaaagttaaaaagaagatcaactttataaaagggcaatggacagtagaagaagatcgg |
34916112 |
T |
|
| Q |
115 |
tacataca |
122 |
Q |
| |
|
|||||||| |
|
|
| T |
34916113 |
tacataca |
34916120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University