View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19128_high_64 (Length: 222)

Name: NF19128_high_64
Description: NF19128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19128_high_64
NF19128_high_64
[»] chr5 (1 HSPs)
chr5 (16-204)||(16385386-16385574)


Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 16385386 - 16385574
Alignment:
16 gagaggaaaagaatcaatgaagtaaaagcgataacaatagcaaaaacagcgattttgctaggcttcattttgtggatccatggtggtgaaagagttgatt 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
16385386 gagaggaaaagaatcaatgaagtaaaagcgataacaatagcaaaaacagcgattttgctaggcttcattttgtggatccacggtggtgaaagagttgatt 16385485  T
116 tggaatggaaatgataacatacaaactgttttttcgtgtctgatgaattgaaaccacagaaaccattgttgttgttgatgcaatcttta 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
16385486 tggaatggaaatgataacatacaaactgttttttcgtgtctgatgaattgaaaccacagaaaccattgttgttgttgatgcattcttta 16385574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University