View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19128_low_37 (Length: 339)
Name: NF19128_low_37
Description: NF19128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19128_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 8e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 219 - 322
Target Start/End: Original strand, 18007015 - 18007118
Alignment:
| Q |
219 |
ggtttagagtaatattgtgagtgggccatggacacagttccctaaactttgggtcttcgttttcatcactcagcttagcttagctcacagccgccccctc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18007015 |
ggtttagagtaatattgtgagtgggccatggacacagttccctaaactttgggtcttcgttttcatcactcagcttagcttagctcacagccgccccctc |
18007114 |
T |
|
| Q |
319 |
actg |
322 |
Q |
| |
|
|||| |
|
|
| T |
18007115 |
actg |
18007118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 18006821 - 18006984
Alignment:
| Q |
18 |
atataaatgttgtattctcaatgaagctannnnnnncacactctagaatcatcnnnnnnnatcacctttatttttggtgagacaaaaagaaacaggtgtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
18006821 |
atataaatgttgtattctcaatgaagctatttttttcacactctagaatcatctt-----------tttttttttggtgagacaaaaagaaacaggtgtt |
18006909 |
T |
|
| Q |
118 |
acaataaatacagagagtaacaaccagcaccaaactctactactctaccatcaa---tattcattcacaagtcat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18006910 |
acaataaatacagagagtaacaaccagcaccaaactctactactctaccatcaatattattcattcacaagtcat |
18006984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University