View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19128_low_46 (Length: 315)
Name: NF19128_low_46
Description: NF19128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19128_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 41 - 272
Target Start/End: Original strand, 21972370 - 21972601
Alignment:
| Q |
41 |
atttcacaagtattggttatactattagattttgatttcttactgcttatttgcgtttatgtgattcttagaatgccaagacttcacttccttgctgcag |
140 |
Q |
| |
|
||||||||||||||| ||||||||||| | || ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21972370 |
atttcacaagtattgcttatactattacaattcagtttcttactgcttatttgcatctatgtgattcttagaatgccaagacttcacttccttgctgcag |
21972469 |
T |
 |
| Q |
141 |
agtacaaacacttaataatcaagccgctcaaactcttttacctggtttatgtttaccatttgacacagctttctttatgcctcaagctctaaatatcaat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21972470 |
agtacaaacacttaataatcaagccgctcaaactcttttacctggtctatgtttaccatttgacacagctttctttatgcctcaagctctaaatatcaat |
21972569 |
T |
 |
| Q |
241 |
cctcgacactaccttgaggtttccatcactaa |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21972570 |
cctcgacactaccttgaggtttccatcactaa |
21972601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University